Home > SN > Detection and identification of Candidatus Liberibacter solanacearum
Detection and identification of Candidatus Liberibacter solanacearum

Basic Information

Standard ID: SN/T 5139-2019

Standard Name:Detection and identification of Candidatus Liberibacter solanacearum

Chinese Name: 马铃薯斑纹片病菌检疫鉴定方法

Standard category:Commodity Inspection Industry Standard (SN)

state:in force

Date of Release2019-09-03

Date of Implementation:2020-03-01

standard classification number

Standard ICS number:Agriculture>>Agriculture and forestry>>65.020.01 Agriculture and forestry combined

Standard Classification Number:Agriculture, Forestry>>Plant Protection>>B16 Plant Quarantine, Pest and Disease Control

associated standards

Publication information

publishing house:China Standards Press

other information

drafter:Liu Weiqi, Zhao Wenjun, Tian Qian, etc.

Drafting unit:Manzhouli Customs, China Institute of Inspection and Quarantine, Hohhot Customs, etc.

Focal point unit:General Administration of Customs of the People's Republic of China

Proposing unit:General Administration of Customs of the People's Republic of China

Publishing department:General Administration of Customs of the People's Republic of China

competent authority:General Administration of Customs of the People's Republic of China

Introduction to standards:

Standard No.: SN/T 5139-2019 Standard Name: Quarantine and Identification Method for Potato Stripe Pathogen English Name: Detection and Identification of Candidatus Liberibacter solanacearum Standard Format: PDF Release Time: 2019-09-03 Implementation Time: 2020-03-01 Standard Size: 18767K Standard Introduction: Industry Standard of Entry-Exit Inspection and Quarantine of the People's Republic of China 1 Scope This standard specifies the detection method for potato stripe pathogen. This standard applies to the quarantine and identification of potato mottle pathogen in imported Solanaceae plants such as potato, tomato, pepper, and Umbelliferae plants such as carrot, coriander, celery, seeds, seedlings, tubers, roots and other plant materials, as well as the transmission vector psyllid. Basic information of potato zebra chip disease Chinese name: potato zebra chip disease Latin name: Candidatus liberibacter solanacearum Liefting et al.,2009 English name: zebra chip, zebra complex Chinese synonyms: zebra chip disease, potato zebra complex Synonyms: Candidatus Liberibacter psyllaurous Hansen et al.,2008Classification status: Belongs to Kingdom monera, Proteobacteria, Alphapro teobacteria, Rhizobiales, Phyllobacteriaceae, Genus Candidatus Liberibacter. Transmission route: Psyllids such as potato psyllid, carrot psyllid, Bactericera trigonia and B. macule!enis are vectors of potato spotted chip disease. They carry and spread the pathogen by feeding on infected plants. In addition, it can be spread over long distances with propagation materials such as seeds, seedlings, tubers and roots, and can also be spread through grafting. For other information on potato spotted chip pathogens, please refer to Appendix A, and for disease symptoms and pictures of transmission vectors, please refer to Appendix B.
This standard specifies the detection method for potato spotted chip pathogens. This standard applies to the quarantine identification of potato spotted chip pathogens in imported Solanaceae plants such as potatoes, tomatoes, peppers, and Umbelliferae plants such as seeds, seedlings, tubers, roots, and other plant materials, as well as transmission vectors such as psyllids.


Some standard content:

ICS65.020.01
Industry Standard of Entry-Exit Inspection and Quarantine of the People's Republic of ChinaSN/T 5139—2019
Industry Standard Information Service Platform for Detection and Identification of Candidatus Liberibacter solanacearum of Potato Stripe
Published on 2019-09-03
General Administration of Customs of the People's Republic of China
Implementation on 2020-03-01
This standard was drafted in accordance with the rules given in GB/T1.1—2009. This standard was proposed and managed by the General Administration of Customs of the People's Republic of China. SN/T5139—2019
Drafting units of this standard: Manchuria Customs of the People's Republic of China, China Institute of Inspection and Quarantine, and Hohhot Customs of the People's Republic of China.
Main drafters of this standard: Liu Weiqi, Zhao Wenjun, Tian Qian, Pan Xubin, Yang Yongsheng, Hang Xiaoxi, Liu Wenmin, Zhang Gui, Meng BinIndustry Standard Information Service Platform
1 Scope
Quarantine identification method for potato stripe pathogenThis standard specifies the detection method for potato stripe pathogen.SN/T5139—2019
This standard applies to the quarantine identification of potato stripe pathogen in imported potato, tomato, pepper and other Solanaceae plants, as well as seeds, seedlings, tubers, roots and other plant materials of Umbelliferae such as carrot, radish and celery, as well as the transmission vector psyllid. 2 Basic information of potato zebra chip pathogen
Chinese name: potato zebra chip pathogen
Latin name: Candidatus Liberibacter solanacearum Liefting et al., 2oo9English name: zebrachip, zebracomplexChinese synonyms: zebra chip disease, potato zebra complexSynonyms: Candidatus Liberibacter psyllaurous Hansen et al., 2oogClassification status: Belongs to Kingdom Monera, Proteobacteria, Alphaproteobacteria, Rhizobiales, Phyllobacteriaceae, Candidatus Liberibacter.
Transmission route: Psyllids such as potato psyllid, carrot psyllid, Bactericeratrigonica and B.maculipennis are the vectors of potato stripe disease. They carry and spread the pathogen by feeding on infected plants. In addition, it can be spread over long distances with propagation materials such as seeds, seedlings, tubers and roots, and can also be spread through grafting. Standard Information Service Platform
For other information on potato stripe disease, please refer to Appendix A, and for disease symptoms and pictures of transmission vectors, please refer to Appendix B. 3 Principle of the method
Mainly based on molecular biological characteristics. 4 Instruments and main reagents
4.1 Instruments
Super clean bench, high-speed refrigerated centrifuge, grinder, small grinder, beating homogenizer, desktop small centrifuge, conventional refrigerator, vortex oscillator, micro-injector, electronic balance, pH meter, water bath, water purifier, autoclave, ultra-low temperature refrigerator, fluorescence quantitative PCR instrument, PCR instrument, electrophoresis instrument, gel imaging analyzer, ice maker, etc. 4.2 Main reagents
Unless otherwise specified, all reagents are analytical grade. TritonX-100, PBS buffer, PCR buffer, dNTPs (dATP, dTTP, dCTP, dGTP), TaqDNA polymerase, primers and probes, isopropanol, anhydrous ethanol, DNA extraction reagents are shown in Appendix C. SN/T5139—2019
5 Identification of pathogens
5.1 Symptom inspection
Take 1% to 5% of the sample (if the sample is small, the proportion can be appropriately increased) of leaves, stems, tubers and other parts for inspection. The symptoms and degree of damage on different hosts or even different varieties of the same host are different. For symptoms, please refer to Appendix A and Appendix B. 5.2 Sample preparationbzxz.net
5.2.1 Plant material sample preparation
Plant materials are homogenized with a grinder or liquid nitrogen, and 3 to 5 plant leaves or stems are taken from symptomatic plants. Take 5 to 10 leaves (including new leaves) or stems from different parts of asymptomatic plants. Select the underground parts of plants with obvious symptoms for testing, such as potato tubers, carrot roots, etc. Before extraction, the material should be sampled twice to ensure that the material contains more vascular tissue, such as petioles, midribs, cambium, or potato tuber vascular rings. 5.2.2 Seed sample preparation
Seed samples can be ground in a mortar, processed in a grinder, or crushed in a plastic bag with a hammer. Alternatively, a beating homogenizer can be used instead of grinding. Seeds treated with seed coating agents should first be removed from the seed coating, and the seeds should be shaken and washed in 1:10 (w/v) 0.5% TritonX-100 for 30 minutes, washed three times, and softened in water overnight. 1g-2g carrot seeds (about 450-900 seeds) sample is added with 50mL-100mL PBS (NaCl, 8g/L; NaH,PO2H,O, 0.4g/L; NazHPO4·12HzO2.7g/L; pH7.2) buffer solution and soaked overnight in a 4℃ refrigerator; discard the buffer solution, grind the seeds with a grinder, add 20mL-40mL PBS buffer solution after grinding, shake and mix, filter with gauze or filter paper, and use the filtrate to extract DNA. PBS buffer (NaCl, 8g/L: KH,PO4, 0.24g/L; NazHPO, 1.44g/L; KCl, 0.2g/L: pH 7.2) can also be used.
5.2.3 Preparation of psyllid samples
Standard Information Service
Take 10-30 psyllids and put them in a centrifuge tube, add appropriate amount of decay solution and grind them with a small grinder, or put them in a mortar and add liquid nitrogen to grind them for later use.
5.3 PCR preliminary screening
5.3.1 DNA extraction from samples
Take 1mL-2mL of the filtrate after filtering the plant tissue or seed treatment liquid, centrifuge at 10000r/min for min. to extract DNA. Conventional CTAB extraction method or commercial DNA extraction kit can be used. After the psyllid samples are prepared, DNA can be extracted using commercial kits.
5.3.2 Molecular biological detection
This standard adopts conventional PCR, nested PCR and real-time fluorescence PCR detection methods, see Appendix C, D and E respectively, and repeat 3 times. Use potato mottle pathogen DNA as positive control, healthy potato DNA as negative control, and sterile distilled water as blank control. 6 Result determination
If any of the three detection methods, conventional PCR, nested PCR and real-time fluorescence PCR, is positive, it can be determined that potato stripe pathogen has been detected.
7 Sample preservation
SN/T5139—2019
The samples shall be properly preserved after registration and signature by the person in charge. Samples detected with potato stripe pathogen shall be stored in a 4℃ refrigerator for review. Such samples shall be sterilized by high pressure after the expiration of the storage period before they can be processed. For samples with positive test results, the samples shall be preserved. Diseased samples shall be stored in a refrigerator at -20℃ or -80℃, and be properly marked and registered.
Result record and data preservation
The complete experimental record includes: the source, type, acceptance time, experimental time, location, method and results of the sample, and shall be signed by the person in charge and the experimenter. PCR detection requires photos of electrophoresis results and sequencing results. Industry standard information service platform
SN/T5139—2019
A.1 Symptoms and characteristics
Appendix A
(Informative Appendix)
Other relevant information on potato zebrafly pathogen The zebrafly pathogen mainly harms the leaves, branches, fruits and other parts of the host plant. The symptoms and degree of damage vary on different hosts or even different varieties of the same host. The aboveground symptoms of potato, tomato and other Solanaceae plants are similar to those of phytoplasmas, including: dwarfing, erect new leaves, chlorotic and purple leaves, upward curling of leaves of the whole plant, shortening and thickening of internodes, formation of clustered leaves, swollen internodes, axillary gum branches or aerial tubers, leaf scorch, deformed fruits, large and small fruits, stagnation of development and poor quality. The underground symptoms of potato include lodging of creeping stems, browning of vascular tissues, accompanied by necrotic spots of internal tissues and stripes of medullary tissues. After deep-frying, these symptoms are more obvious, and black spots or stripes appear on French fries or chips, thus losing their commercial value. The disease is named "spotted flake disease" because of the striped symptoms on the potato tubers. Symptoms on carrots are similar to those of phytoplasma and spirochetal diseases, including: curled leaves, yellowing, purple or reddish brown leaves, stunted seedlings and roots, and hyperplasia of secondary roots.
A.2 Host range
Currently reported hosts include Solanum tuberosum, S. lycopersicum, Capsicumannuum, S. betaceum, Nicotiana tabacum, S. melongena, Physalis peruviana, S. elaeagnifolium, S. ptycanthum, and Lycium barbarum. Umbelliferae includes: carrot Dacus carota, celery Apium graueolens, fennel Foeniculumuulgare, radish Petroselinum crispum, parsnip Fastiratesativa, parsley Libanotisseseloides and parsnip Pastinacsativa, etc. Its potential host range is wider than the known host range. Standard Information
A.3 Distribution
Hui Service Platform
Currently, it has been reported in 17 countries and regions around the world, and its distribution range is still expanding. The specific distribution countries and regions are as follows: North America: Mexico, the United States
Central America: El Salvador, Guatemala, Honduras, Nicaragua. Oceania: New Zealand.
Europe: Finland, France, Norway, Spain, Sweden, Germany, Austria, the United Kingdom. Africa: Morocco.
Asia: Israel.
A.4 Infection Pathways
The pathogen can be spread over long distances through infected tubers and seeds and other compact breeding materials: by insect vectors. In addition, the pathogen can also be spread and diffused through grafting, infected plants, infected seeds and potato seed potatoes. The currently reported transmission vectors include: potato psyllid Bactericeracockerelli, carrot psyllid Triozaapicalis, psyllid B.trigonica and psyllid B.maculipennis. 4
Appendix B
(Informative Appendix)
Pictures of disease symptoms and transmission vectors
SN/T5139—2019
Standard Information Service
Service Platform
a-btc-I Quick
Symptoms on potato leaves and tubers (cited from Munyaneza JE.) SN/T5139—2019
Symptoms of leaf curl, chlorosis and yellowing on tomatoes
Symptoms of chlorosis and yellowing on tomatoes
Figure B.4 Symptoms on carrots (a. Leaf curl and purple; b. Leaf curl only; c. No symptoms) Industry Standard Letter
Figure 3.6 Adults of Psyllids
Figure B.5 Eggs, nymphs and adults of Potato Psyllids||tt| |(Figures B.2 and B.3 are from Dr. Tang Ziying of the Plant Health and Environment Laboratory of the Ministry of Primary Industries of New Zealand; Figures B.4, B.5 and B.6 are from EPPO)
C.1 Conventional PCR amplification
Appendix C
(Normative Appendix)
Conventional PCR method
SN/T5139—2019
Primers LsoTX16/23F(5-aattttagcaagttctaaggg-3)/LsoTX16/23R(5-ggtacctcccatatcgc-3); reaction procedure: 94℃3min; 94℃30s, 55℃30s.72℃40s.40 cycles; 72℃5min. The expected amplification product is 383bp.
PCR reaction system
Reagent name
PCR buffer
Magnesium chloride
Upstream primer
Downstream primer
TaqDNA polymerase
Template DNA
50mmol/L
10mmol/L
10μmol/L
10μmol/L
5U/μL
≥10ng/μL
Sample volume/μL
Make up to 25μL
In the above reactions, positive control (potato stripe pathogen), negative control (healthy potato leaves) and blank control (using standard signal
distilled water instead of template DNA) should be performed at the same time.
C.2 Agarose gel electrophoresis
Prepare 1.5% agarose gel, mix the electrophoresis loading buffer and PCK amplification product in proportion, use DNA Marker as a molecular weight marker, and perform electrophoresis analysis. After the electrophoresis, observe whether the expected specific DNA band is amplified under the ultraviolet projection light of the gel imager. Take pictures and record.
C.3 Result determination
Our service platform
PCR amplification product electrophoresis detection: the positive control has the expected amplification fragment, the negative control has no target band, the sample to be tested is positive if the expected amplification fragment appears, and negative if the expected amplification fragment does not appear. SN/T5139—2019
D.1 Nested PCR amplification
Appendix D
(Normative Appendix)
Nested PCR method
Primers used were the potato leaf disc pathogen 16SrDNA universal primers OA2/OI2c and Lib16S01F/Lib16S01R. The primer sequences are shown in Table D.1.
Primer name
Lib16So1F
Lib16So1R
Primers for nested PCR detection
Primer sequence 5'-3
gcgcttatttttaataggagcggca
gcctcgcgacttcgcaacccat
ttctacgggataacgcacgg
cgtcagtatcaggccagtgag
Product/bp
The first round of PCR reaction was carried out with primers OA2/OI2c. The reaction conditions were: 94℃/5min; 94℃/30s, 58℃/30s, 72℃/1min.30 cycles; 72℃/10min. The PCR reaction system is shown in Table D.2. 2PCR reaction system
Reagent name
PCR buffer
Magnesium chloride
Upstream primer
Downstream primer
TagDNA polymerase
Template DNA
50mol/L
10mmol/L
10μmol/L
10μmol/L
5U/μl
≥10ng/μL
Sample volume/μL
According to the standard
Fill to 25μ
Take 1μL of the first round PCR product as a template and use the universal primers Lib16SO1F/Lib16S01R for the second round of PCR reaction. The reaction system is shown in Table D.2. The reaction conditions are: 94℃/5min; 94℃/30s, 58℃/30s, 72℃/1min, 35 cycles; 72℃/10min.
In the above reactions, positive control (potato mottle pathogen), negative control (healthy potato leaves) and blank control (distilled water instead of template DNA) are required.
Agarose gel electrophoresis
Preparation 1.5% agarose gel, mix electrophoresis loading buffer and PCR amplification product in proportion. Use DNAMarker as molecular weight marker for electrophoresis analysis. After the electrophoresis, observe whether the expected specific DNA band is amplified under the ultraviolet projection light of the gel imager, and take pictures and record.
D.3 Result determination
PCR amplification product detection, a 580bp DNA fragment appears in the positive control, and the negative control and blank control do not have this nucleic acid band. If the sample to be tested has a 580bp DNA fragment, the test result is positive, and if no 580bp DNA fragment appears, the test result is negative.
Industry Standard Information Service Platform
SN/T5139—2019
E.1 Fluorescence PCR Detection
Appendix E
(Normative Appendix)
Real-time fluorescence PCR method
LsoF (5'-gtcgagcgcttattttaatagga-3)/HLBr (5'-gcgttatcccgtagaaaaaggtag-3') and probe HLBP (5FAM-agacgggtgagtaacgcg-BHQ-3). PCR reaction program: 95℃10min95℃15s, 58℃1min, 40 cycles. The reaction system is shown in Table E.1.
Reagent name
PCR buffer (containing 25mmol/L MgSO,)
Sense primer
Antisense primer
TaqDNA polymerase
DNA template
Result determination
Real-time fluorescence PCR reaction system
2.5mmol/L each
10μmol/L
10μmol/L
5U/μL
10 μmol/L
≥50ng/μL
Industry standard
Sample volume/μL
Fill to 25
Real-time fluorescence detection, positive control Ct value ≤30, negative control and blank control no amplification or Ct value>40: sample Ct value ≤35 official information service platform
is positive: if between 35 and 40, the test needs to be repeated. If the repeated result Ct value is still between 35 and sample no amplification or Ct value>40, it is negative. 10
, it is judged as positive, otherwise it is judged as negative:
Tip: This standard content only shows part of the intercepted content of the complete standard. If you need the complete standard, please go to the top to download the complete standard document for free.